Artikel » Barcode DNA: Sistem Identifikasi Mutakhir untuk Organisme

Media:Buletin, 07 Agustus 2014
Link:http://biogen.litbang.pertanian.go.id/index.php/publikasi/warta-biogen/
Ringkasan:

Pernahkah anda memperhatikan seorang kasir di supermarket mencatat harga barang ke dalam komputer hanya dengan men-scan label bergaris yang ada angka di bawahnya menggunakan scanner sederhana dan harganya langsung muncul di layar monitor? Kode-kode seperti itulah yang digunakan supermarket untuk menandai setiap barang. Barang yang telah dilabel dimasukkan dalam database di komputer yang bisa diupdate sewaktu-waktu sehingga tidak mungkin tertukar. Cara/teknologi ini membuat kasir lebih mudah dan cepat dalam bekerja tanpa ada kesalahan. Teknologi pelabelan ini dikenal dengan nama barcode. Barcode ditemukan pada tahun 1949 oleh dua orang Amerika, yaitu Bernard Silver dan Norman Joseph Woodland. Meski barcode telah dipatenkan pada 7 Oktober 1952, tetapi sistem barcode dengan garis linier hitam-putih mulai digunakan secara komersial lima belas tahun kemudian. Dari beberapa sistem barcode yang telah digunakan, hanya Universal Product Code (UPC) yang terdiri dari 12 angka yang dipakai oleh banyak industri. Barcode yang digunakan Indonesia adalah sistem European Articles Numbering (EAN) yang memiliki 13 digit yang terdiri dari 12 angka dan 1 cek digit. Semua produk berbarcode diatur oleh menteri perdagangan dunia. Setiap negara memiliki kode barcode sendiri sehingga tidak tertukar dengan negara lain. Penggunaan barcode sistem linear ini tidak terbatas pada produk yang terdaftar pada kementerian perdagangan saja, tapi setiap orang bisa membuat barcode sendiri untuk keperluan tertentu. Misalnya, barcode untuk produk segar seperti ikan, sayuran, buah-buahan di supermarket. Barcode juga sudah biasa digunakan untuk memberi tanda barang-barang pada penerbangan dan memberi label suatu percobaan.

Barcode DNA dan Aplikasinya Atas dasar itulah para ilmuwan saat ini tengah memikirkan cara memberi kode suatu organisme hidup dengan sistem barcode seperti barcode pada produk buatan. Pada produk buatan jauh lebih mudah memberi kode angka karena produk tidak akan berubah dan selalu terdaftar pada instansi yang berwenang. Lain halnya dengan mahluk hidup yang selalu berkembang biak dan terjadi perkawinan, sehingga individu satu akan berbeda dengan individu lainnya walaupun masih berada di dalam satu spesies. Pada manusia, sidik jari tangan dapat digunakan sebagai identifikasi masing-masing orang, karena bersifat unik dan tidak ada sidik jari yang sama antar manusia. Namun, sidik jari ini berlaku apabila manusia tersebut masih hidup. Ketika manusia mati, maka sidik jari tangan akan hilang. Oleh karena itulah sidik jari yang tak pernah hilang sepanjang waktu adalah sidik jari DNA. Asumsi para ilmuwan adalah masing-masing spesies (barangkali nantinya masing-masing individu) sebenarnya memiliki DNA yang unik yang bisa digunakan sebagai penanda seperti barcode. Para ilmuwan yang berkecimpung di dalam ilmu taksonomi telah menyadari perlunya identifikasi suatu mahluk hidup menggunakan DNA. DNA yang dijadikan barcode harus unik untuk setiap spesies. Pemberian barcode ini diharapkan bisa membantu banyak orang secara cepat dan murah untuk mengenal suatu spesies dan seluruh informasi yang terkait dengannya, dan juga akan bisa secara cepat mengenali penemuan jutaan spesies lain yang belum dinamai. Sistem barcode DNA ini diharapkan bisa memonitor perubahan biodiversity di dunia. Penelitian barcode DNA ini merupakan pekerjaan yang komplek, dan tidak mungkin dilakukan oleh satu instansi saja. Oleh karena itu pada tahun 2003 dibentuklah Consortium for the Barcode of Life (CBOL). Konsorsium ini mengakomodir hasil-hasil penelitian dari anggota dan saling tukar informasi yang terkait dengan kegiatan tersebut. CBOL berpusat di National Museum of Natural History, Washington DC, Amerika Serikat. Sampai saat ini CBOL telah beranggotakan sekitar 130 organisasi dari 43 negara. Namun sayang sekali Indonesia tidak masuk sebagai anggota konsorsium, padahal Indonesia termasuk salah satu negara dengan biodiversitas yang kaya. Bagaimana membuat barcode mahluk hidup? Menurut petunjuk dari CBOL ada empat komponen yang diperlukan di dalam penelitian barcode, yakni:

  1. Spesimen: bisa berupa fosil, jaringan beku, benih, dan lain-lain.
  2. Laboratorium analisis. Di sini dibutuhkan alat-alat untuk keperluan isolasi DNA, PCR, dan elektroforesis.
  3. Database. Database ini berupa data-data yang sudah dikoleksi dan bisa dicocokkan dengan spesimen yang sedang dianalisis. Di sinilah perlunya kerja sama yang erat antara institusi antar negara (di dalam CBOL) untuk tukar informasi, agar diketahui spesimen yang diteliti apakah sudah terdaftar sebagai spesies ataukah belum diketahui spesies apa.
  4. Data analisis. Kegiatan ini tentu saja membutuhkan program dan peralatan komputer yang handal. Data molekuler yang telah didapatkan tentu saja harus bisa dicari kesesuaiannya dengan database yang ada secara cepat dan akurat.

Di Korea, spesimen diekstraksi DNA dan dilakukan PCR dengan primer spesifik. Data yang ada disimpan di dalam pusat bank data dan dapat digunakan untuk mengidentifikasi spesies yang lain. Indonesia pun bisa meniru model seperti di Korea ini, namun perlu manajemen penelitian yang lebih baik, karena menyangkut banyak institusi. Setiap lembaga yang terkait dengan itu, misal LIPI, Badan Litbang Pertanian, Badan Litbang Kehutanan, dan lain-lain bisa membentuk konsorsium barcode DNA khusus tanaman Indonesia. Namun, sudah seyogyanya Indonesia harus masuk ke dalam CBOL karena informasi tentang barcode DNA akan terbuka lebar di tempat tersebut. Informasi yang sangat penting terkait dengan primer-primer spesifik yang bisa digunakan untuk membuat barcode DNA dapat diperoleh di situ.

Primer Spesifik Barcode DNA Peneliti yang berkecimpung di barcode DNA menyadari bahwa diperlukan alat penanda yang sederhana dan bisa membedakan satu spesies dengan spesies yang lain. Pada penelitian DNA harus ada primer yang bisa membedakan secara tegas dan jelas. DNA inti tidak terlalu banyak variasi di antara spesies. Misalkan DNA inti pada manusia berbeda hanya 0,9% dengan DNA simpanse, sedangkan DNA mikrokondrianya berbeda 9%. Oleh karena itu penyusunan barcode DNA bukan berasal dari DNA inti, tetapi DNA di luar inti. Pada hewan, DNA mikondria dijadikan dasar untuk penyusunan barcode DNA, sedangkan pada tanaman oleh karena jumlah dan variasi sekuen mitokondrianya relatif kecil, maka DNA plastida (kloroplas) dijadikan dasar sebagai bahan membuat barcode DNA. Pada jamur, gen-gen ribosomal RNA (SSU rRNA) bisa dijadikan dasar pembeda (Stoeckle, 2003). DNA sebagai barcode ini harus memiliki ukuran yang pendek tapi memiliki variasi yang tinggi antarspesies, dan harus bisa mengakomodir 10-100 juta spesies. Pada penelitian lebih detil ternyata tidak seluruh sekuen mitokondria bisa dijadikan alat barcode. Gen cytochrome c oxidase I (COI) dapat digunakan sebagai dasar pembeda antar binatang (Hebert et al., 2003). Primer yang digunakan akan menghasilkan produk sebesar 658 bp (LCO1490 5’GGTCAACAAATCATAAAGATATTGG -3’ dan HCO2198 5’-TAAACTTCAGGGTGACCAAAAAATCA-3’). Produk PCR inilah yang kemudian disekuen untuk kemudian dilihat susunan basa nitrogennya. Ternyata antarspesies pada hewan bisa dibedakan dari perbedaan urutan basanya. Apabila empat basa digunakan sebagai dasar maka kemungkinan jumlah spesies yang bisa dibedakan sekitar 4658 atau tidak terhingga. Peluang untuk membuat barcode DNA pada hewan sangat besar, namun diperlukan kerja yang besar karena harus bekerja pada jutaan spesies yang ada di dunia. Bagaimanakah penyusunan barcode pada tanaman? Sistem barcode pada tanaman ternyata tidak semudah yang dilakukan pada hewan. Setelah dilakukan penelitian bertahun-tahun CBOL pada tahun 2009 menawarkan dua daerah pada kloroplas yang bisa dijadikan dasar untuk barcode tanaman, yakni lokus rbcL dan matK. Penelitian itu sendiri telah menyaring tujuh lokus pada kloroplas menjadi hanya dua lokus saja. Tujuh lokus tersebut adalah atpF-atpH spacer, matK gene, rbcL gene, rpoB gene, rpoC1 gene, psbk-psbl spacer, dan trnHpsbA spacer. Primer-primer kedua lokus utama tersebut dapat diperoleh di http://www.barcoding.si.edu/. Namun, penggunaan primer-primer tersebut masih bersifat “trial” karena belum ada yang benar-benar bisa membedakan antar spesies tanaman. Hollingsworth (2011) menawarkan primer tambahan, yakni nuclear ribosomal DNA transcribed spacer (nrDNA ITS) untuk menambah keakuratan data. Namun, beberapa peneliti mengkhawatirkan adanya kontaminasi dengan jamur karena nrDNA ITS umumnya digunakan sebagai pembeda pada jamur (Schoch et al., 2012). Peneliti barcode tanaman di Cina melaporkan hanya 2-3% terkontaminasi jamur dari sampel yang digunakan. Penelitian barcode pada tanaman ini masih berlangsung terus, dan diharapkan dalam waktu tidak terlalu lama sudah diperoleh barcode DNA tanaman yang akurat dan bisa membedakan antarspesies tanaman.

Barcode DNA dan Perlindungan Varietas Tanaman Penelitian barcode tanaman ini sampai saat ini baru bisa membedakan antarspesies saja dan belum ditemukan primer spesifik yang bisa membedakan individu di dalam satu spesies. Misal pada genus Oryza L. terdapat 25 spesies dan genus Capsicum terdapat 20-27 spesies, maka barcode DNA tanaman yang bisa dibuat hanya akan efektif untuk membedakan antar ke-25 spesies padi dan 20-27 spesies cabe. Oleh karena itu, barcode DNA akan sulit dibuat untuk padi IR64, Code, Ciherang, dan lain-lain yang sama-sama masih satu spesies. Teknologi yang dimiliki oleh dunia saat ini hanyalah primer yang menghasilkan sekuen yang bisa membedakan antarspesies tanaman, bukan intra spesies. Barangkali, seandainya barcode DNA tanaman tersebut sudah lengkap, penelitian selanjutnya akan diarahkan kepada barcode DNA intra spesies, atau bahkan antar individu tanaman. Penelitian sidik jari DNA yang terdapat dalam DIPA BB Biogen beberapa waktu yang lalu sebaiknya diarahkan untuk membuat identitas spesifik untuk tanaman yang populer di masyarakat, dan bukan diarahkan kepada pembuatan barcode DNA seluruh sampel yang dianalisis. Penelitian ini lebih mudah dengan memilih satu varietas saja sebagai “core” yang akan dibuat identitas secara molekuler. Beberapa varietas yang bisa dicoba untuk dibuat identitas molekulernya seperti padi Ciherang, mangga Harumanis, dan tanaman lainnya yang dianggap paling populer di Indonesia. Namun, pekerjaan ini juga tidak mudah mengingat tanaman pembanding yang digunakan masih dalam satu spesies, sehingga kemiripan genom masih mungkin terjadi. Hasil identifikasi molekuler tersebut selanjutnya bisa dicatatkan kepada instansi berwenang, seperti Pusat Perlindungan Varietas Tanaman dan Perizinan Pertanian (PPVTPP), di bawah Kementerian Pertanian RI. Dengan tercatatnya varietas elit tersebut di kantor PPVTPP, maka negara lain tidak bisa mengklaim varietas tersebut miliknya. Seandainya Indonesia berkeinginan memberikan kontribusi terhadap pembuatan barcode organisme hidup, akan lebih baik bila menjadi anggota pusat barcode organisme hidup (CBOL).

Daftar bacaan: CBOL Plant Working Group. A DNA barcode for land plants. PNAS 106(31):12794-12797. Hebert, P.D.N., A. Cywinska, S. L. Ball, and J.R. deWaard. 2003. Biological identifications through DNA barcodes. Proc. R. Soc. Lond. B. 270:313-321. Hollingsworth, P.M. 2011. Refining the DNA barcode for land plants. PNAS 108(49):19451-19452. Schoch, C.L., K.A. Seifert, S. Huhndorf, V. Robert, J.L. Spouge, C.A. Levesque, W. Chen, and Fungal Barcoding Consortium. 2012. Nuclear ribosomal internal transcribed spacer (ITS) region as a universal DNA barcode marker for fungi. PNAS 109(16):6241-6246. Stoeckle, M. 2003. Taxonomy, DNA, and the Barcode of life. BioScience 53(9):2-3.

Sumber artikel: Warta Biogen Vol. 9, No. 2, Agustus 2013.

Penulis: Tasliah, S.Si., M.Si. (BB-Biogen)
Download:PDF (283,7 KB)